Skip to content

Natay/bio

 
 

Folders and files

NameName
Last commit message
Last commit date

Latest commit

 

History

338 Commits
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 

Repository files navigation

bio: making bioinformatics fun again

Work in progress.

bio - command-line utilities to make bioinformatics explorations more enjoyable.

Typical usage:

bio task data1 data2 --param1 --param2

where task can be: fetch, align, convert and many others.

Quick links

What does this software do?

This software is designed to teach bioinformatics concepts.

If you've ever done bioinformatics, you know how even seemingly straightforward tasks require multiple steps, arcane incantations, and various other preparations that slow down progress.

Even well-defined, supposedly simple tasks can take a seemingly inordinate number of complicated steps. The bio package is meant to solve that tedium. With bio, you can write things like this:

bio fetch NC_045512 --rename ncov
bio fetch MN996532  --rename ratg13

to fetch the data from NCBI and rename data to more meaningful labels, then write:

bio align ncov:S ratg13:S --end 60 --pep1

to align the DNA for the S protein while also showing the translation with one letter peptide code:

# Ident=57(95.0%)  Mis=3(5.0%)  Gaps=0(0.0%)  Target=(1, 60)  Query=(1, 60)  Length=60  Score=273.0  NUC.4.4(11,1)

              M  F  V  F  L  V  L  L  P  L  V  S  S  Q  C  V  N  L  T  T
YP_009724390 ATGTTTGTTTTTCTTGTTTTATTGCCACTAGTCTCTAGTCAGTGTGTTAATCTTACAACC
             ||||||||||||||||||||||||||||||||.||||||||||||||||||||.|||||. 60
QHR63300.2   ATGTTTGTTTTTCTTGTTTTATTGCCACTAGTTTCTAGTCAGTGTGTTAATCTAACAACT
              M  F  V  F  L  V  L  L  P  L  V  S  S  Q  C  V  N  L  T  T

bio was designed to use words that make sense: align, translate, complement, protein, taxon, type, etc. If you wanted to align the same sequences when translated into proteins bio lets you write:

bio align ncov:S ratg13:S --end 60 --translate 

to generate:

# Ident=20(100.0%)  Mis=0(0.0%)  Gaps=0(0.0%)  Target=(1, 20)  Query=(1, 20)  Length=20  Score=98.0  BLOSUM62(11,1)

YP_009724390 MFVFLVLLPLVSSQCVNLTT
             |||||||||||||||||||| 20
QHR63300.2   MFVFLVLLPLVSSQCVNLTT

Beyond alignments, there is a lot more to bio. We recommend looking at the documentation

Who is bio designed for?

The software was written to teach bioinformatics and is the companion software to the Biostar Handbook textbook. The targeted audience comprises:

  • Students learning about bioinformatics.
  • Bioinformatics educators who need a platform to demonstrate bioinformatics concepts.
  • Scientists working with large numbers of similar genomes (bacterial/viral strains).
  • Scientists who need to investigate and understand the precise details of a genomic region closely.

The ideas and motivations fueling bio have been developed while educating the many cohorts of students who used the handbook in the classroom.

You see, in bioinformatics, many tasks that should be straightforward are, instead, needlessly complicated. bio is an opinionated take on how bioinformatics, particularly data representation and access, should be simplified.

Documentation

The documentation is maintained at

Quick install

bio works on Linux and Mac computers and on Windows when using the Linux Subsystem.

pip install bio --upgrade

See more details in the documentation.

Development

If you clone the repository, we recommend that you install it as a development package with:

python setup.py develop

Testing

Testing uses the pytest framework:

pip install pytest

To run all tests, use:

make test

Tests are automatically built from a test script that mimics real-life usage scenarios.

New tests

To add a new test, first run the command you wish to test, for example:

bio fetch foo --gff > output.gff

in the test/data directory. After that, add the same command above into the master script:

followed by:

make build_tests

The latter command will automatically generate a Python test for each line in the master script.

The automatically generated test will verify that the command is operational and that the output matches the expectations.

Generating documentation

To generate the docs, you will need the bookdown package:

conda install r-bookdown r-servr

To run the docs in a browse:

make 

then visit http://localhost:8000

To render the docs write:

make docs

To push out the latest docs:

make sync

About

Bioinformatics utilities.

Resources

License

Stars

Watchers

Forks

Releases

No releases published

Packages

 
 
 

Contributors

Languages

  • Python 69.8%
  • Perl 27.7%
  • Shell 2.1%
  • Makefile 0.4%