Skip to content

walaj/svaba

Repository files navigation

SvABA — Structural variation and indel analysis by assembly

SvABA (formerly Snowman) is an SV and indel caller for short-read BAMs. It performs genome-wide local assembly with a vendored SGA, realigns contigs with BWA-MEM, and scores variants by reassembled read support. Tumor/normal, trios, and single-sample modes are supported; variants are emitted as VCF plus a verbose tab-delimited companion (bps.txt.gz) that carries the full per-sample evidence.

License: GNU GPLv3. Uses the SeqLib API for BAM I/O, BWA-MEM alignment, interval trees, and the assembly front-end.

Install

Dependencies

Package Required? Purpose
CMake ≥ 3.14 yes build system
htslib yes BAM/CRAM/VCF I/O
zlib yes gzip in/out
pthread yes worker threads
BZip2, lzma yes htslib compression deps
sqlite3 optional enables --dump-reads r2c.db output (see below)
jemalloc optional recommended on Linux at -p 16+ (allocator contention)

When sqlite3 isn't found, svaba builds successfully but --dump-reads skips the ${ID}.r2c.db file with a single startup warning; other --dump-reads outputs (corrected.bam, weird.bam, discordant.bam) are unaffected. If you don't use --dump-reads, sqlite3 isn't exercised at all and you can ignore it. To enable r2c.db (so the docs/r2c_db_explorer.html viewer has something to load), install:

  • macOS: brew install sqlite (also pre-installed)
  • Debian/Ubuntu: sudo apt install libsqlite3-dev
  • Fedora/RHEL: sudo dnf install sqlite-devel

…then re-run cmake.

Building

CMake auto-detects htslib via pkg-config or the default include/lib search paths:

git clone --recursive https://github.com/walaj/svaba
cd svaba && mkdir build && cd build
cmake .. && make -j

For a non-standard htslib install location, point at it explicitly:

cmake .. -DHTSLIB_DIR=/path/to/htslib-1.xx
make -j

To link jemalloc at compile time (recommended on Linux for -p 16+ runs — eliminates allocator contention, no LD_PRELOAD needed):

cmake .. -DUSE_JEMALLOC=ON
make -j

The binary lands at build/svaba. To install it system-wide (or into this repo's bin/), use CMake's install target — the default prefix is /usr/local and needs sudo, or override it with -DCMAKE_INSTALL_PREFIX:

make install                                           # /usr/local/bin/svaba
cmake --install build --prefix $(pwd)/..               # repo-local bin/svaba

Build type defaults to RelWithDebInfo (-O2 -g -DNDEBUG). The vendored SeqLib/bwa and SeqLib/fermi-lite hardcode -O2 in their Makefiles; see CLAUDE.md for how to push them to -O3 -mcpu=native (typically a 5–15% wall-time win).

Assembler selection

By default svaba assembles contigs with fermi-lite (ropebwt2-based, the faster path). The vendored SGA (String Graph Assembler) is still fully supported but off by default — switch it on at compile time by passing -DSVABA_ASSEMBLER_FERMI=0 to CMake:

cmake .. -DSVABA_ASSEMBLER_FERMI=0
make -j

The choice is a single compile-time symbol in src/svaba/SvabaAssemblerConfig.h; you can also flip it by editing that file directly and rebuilding. Runtime logs report the active assembler under svaba::kAssemblerName, so you can always confirm which engine a build was compiled with.

jemalloc (Linux, high thread count)

On Linux, running svaba with jemalloc as the allocator typically wins 10–20 % wall-time at -p 16+ (large WGS, tumor/normal). svaba's per-thread assembly loop generates heavy malloc/free traffic and glibc's default allocator serializes on its arena locks under that contention pattern; jemalloc's thread-local arenas sidestep the problem. The repo ships a drop-in wrapper at ./svaba_jemalloc that LD_PRELOADs the system libjemalloc.so.2 and then exec's svaba:

# one-liner replacement for `svaba run ...`:
./svaba_jemalloc run -t tumor.bam -n normal.bam -G ref.fa -a my_run -p 16 \
                     --blacklist tracks/hg38.combined_blacklist.bed

Install jemalloc first (apt install libjemalloc2, yum install jemalloc, dnf install jemalloc). The wrapper auto-detects the library under the standard distro paths; if yours is elsewhere, set JEMALLOC_LIB=/path/to/libjemalloc.so.2. If the svaba binary isn't on your $PATH, set SVABA=/path/to/svaba.

For very high concurrency (-p 24+), also pass jemalloc's own tuning knobs via MALLOC_CONF:

MALLOC_CONF=background_thread:true,narenas:24,dirty_decay_ms:10000 \
    ./svaba_jemalloc run -p 24 ...

narenas should match or modestly exceed the thread count; background_thread:true asks jemalloc to reclaim dirty pages on a background thread instead of in the hot path.

macOS users should not use jemalloc. Apple's native libmalloc (with its nanomalloc fast path for small allocations) and the DYLD_INSERT_LIBRARIES mechanism combine to run 5–10× slower than system malloc on this exact workload in our A/B tests. The wrapper refuses to run on Darwin for that reason. Stick with the system allocator on macOS.

Quick start

Three steps. Run the caller, merge + dedup + index the per-thread outputs, then convert the deduped bps.txt.gz to VCF. The bundled combined blacklist is strongly recommended — it keeps svaba out of well-known pileup / high-complexity regions that would otherwise dominate wall-clock time with no real calls to show for it. See tracks/README.md for customizing or extending the blacklist.

# 1. Call: tumor/normal on chr22 with 4 threads, bundled blacklist
svaba run -t tumor.bam -n normal.bam -G ref.fa -a my_run -p 4 \
          -k chr22 \
          --blacklist tracks/hg38.combined_blacklist.bed

# 2. Post-process: merge per-thread BAMs, sort+dedup+index,
#    sort+dedup bps.txt.gz, filter r2c to PASS.
scripts/svaba_postprocess.sh -t 8 -m 4G my_run

# 3. Convert the deduped bps.txt.gz to VCFv4.5 (SV + indel)
svaba tovcf -i my_run.bps.sorted.dedup.txt.gz -b tumor.bam -a my_run

A single-sample call drops -n. Any number of cases/controls can be jointly assembled; prefix on the sample ID drives case/control routing (t* = case, n* = control).

Subcommands

SvABA is a multi-tool binary. svaba help lists everything. The main ones:

svaba run performs the whole assembly + variant-calling pipeline. Takes a BAM (or many) plus a reference, a blacklist, and an output ID. Emits bps.txt.gz, per-sample VCFs, contigs.bam, runtime.txt, and (with --dump-reads) per-thread *.discordant.bam, *.corrected.bam, *.weird.bam, and *.r2c.txt.gz.

svaba postprocess sorts, deduplicates, @PG-stamps, and indexes the per-thread BAMs and the bps.txt.gz emitted by svaba run. Typically invoked via scripts/svaba_postprocess.sh which also merges per-thread files and builds the PASS / PASS-somatic r2c subsets.

svaba tovcf converts a deduplicated bps.txt.gz into VCFv4.5 output (one SV VCF, one indel VCF; somatic distinguished by the SOMATIC INFO flag). Clean intrachrom events emit as symbolic <DEL>/<DUP>/ <INV>; everything else stays paired BND. Input is assumed already sorted/deduped by svaba_postprocess.sh — use --dedup to opt back into the legacy internal dedup.

The SOMATIC flag is stamped when a record's somatic LOD (INFO/SOMLOD) meets or exceeds a configurable cutoff; the default is 1.0, which is a reasonable "confident somatic" gate and keeps marginal calls out of the somatic set. Tune it with --somlod:

svaba tovcf -i deduped.bps.txt.gz -b tumor.bam -a my_run            # default somlod >= 1
svaba tovcf ... --somlod 2.0                                         # stricter: only strong somatic calls
svaba tovcf ... --somlod 0.0                                         # permissive: flag anything with LO_s >= 0

The raw score is always written to INFO/SOMLOD regardless of the cutoff, so downstream bcftools view -i 'INFO/SOMLOD >= 3' still works if you want to re-threshold after the fact without regenerating the VCF.

svaba refilter re-runs the LOD cutoffs / PASS logic on an existing bps.txt.gz with new thresholds, regenerating VCFs without rerunning assembly. Use it when you want to tune sensitivity/specificity after the fact.

Output files

${ID}.bps.txt.gz is the primary output — one row per breakpoint, with a v3 schema of 52 core columns + per-sample blocks (see BreakPoint::header for column names). The 52nd column is a unique bp_id of the form bpTTTNNNNNNNN that joins back to the BAM aux tags and the VCF EVENT= field. ${ID}.contigs.bam holds every assembled contig, ${ID}.runtime.txt holds per-region timing, and ${ID}.log carries the run log.

The VCF files (${ID}.sv.vcf.gz, ${ID}.indel.vcf.gz) declare VCFv4.5, use symbolic alleles where unambiguous, and carry the canonical scoring in INFO: MAXLOD (variant-vs-error, per-sample max), SOMLOD (somatic LLR), SOMATIC (flag), and SVCLAIM (evidence class). VCF QUAL defaults to . — filter on FILTER=PASS or the two LOD fields, not QUAL. See CLAUDE.md for the full scoring model.

Opt-in outputs (gated behind --dump-reads): ${ID}.r2c.txt.gz is a structured, re-plottable dump of every contig + its r2c-aligned reads; ${ID}.corrected.bam / ${ID}.weird.bam / ${ID}.discordant.bam carry per-read evidence streams. These can run to tens of GB on deep samples, so they're off by default.

Post-processing pipeline

svaba run emits per-thread, unsorted BAMs and a raw per-thread r2c.txt.gz. Merge + sort + dedup + filter them with one command:

scripts/svaba_postprocess.sh -t 8 -m 4G my_run

Five idempotent steps: merge per-thread BAMs and r2c files, run svaba postprocess (sort + stream-dedup + @PG-stamp + index), sort and dedup bps.txt.gz with PASS filter, emit PASS / PASS-somatic subsets of r2c.txt.gz, and (optional) demux the BAMs by source prefix. See CLAUDE.md for the full flag surface.

Viewers

All-HTML, no server, drop files in from file://. Entry point: viewer/index.html. The primary viewer is bps_explorer.html — sortable bps.txt.gz table with chip filters, per-sample detail panel, log10 histograms for somlod/maxlod/span, and click-to-IGV navigation. r2c_explorer.html re-plots the structured r2c TSV in browser (contig ruler, fragment rows, indel || marker rows with labels, per-read gap-expanded CIGAR, bp_id filter dropdown). runtime_explorer.html visualizes runtime.txt; comparison.html does side-by-side diffs of two runs.

viewer/alignments_viewer.html still renders the legacy alignments.txt.gz ASCII output, but new runs don't produce that file — r2c_explorer.html is the replacement.

Blacklists

tracks/hg38.combined_blacklist.bed is the ready-made blacklist; feed it to svaba run --blacklist. It is a regeneratable union of component BED files in tracks/ (ENCODE, high-runtime regions, manual curations, simple repeats, non-standard contigs, and a low-mappability blacklist derived from paired mosdepth runs). See tracks/README.md for the recipe.

Debugging recipes

Trace a specific read through the entire pipeline

Compile with -DSVABA_TRACE_READ to get per-decision-point stderr output for a single read (by QNAME) from BAM ingestion through to output tagging. Zero runtime cost when not compiled in (all trace macros compile to no-ops).

cmake -B build -DCMAKE_BUILD_TYPE=RelWithDebInfo \
      -DCMAKE_CXX_FLAGS='-DSVABA_TRACE_READ="\"LH00306:129:227V5CLT4:6:1204:38807:7191\""'
cmake --build build -j$(nproc)

# Run on just the region containing the read (faster iteration)
svaba run -t tumor.bam -n normal.bam -G ref.fa -p 4 \
    -k chr2:215000000-216000000 --dump-reads -a trace_run 2> read_trace.log

grep READ_TRACE read_trace.log

The trace covers every gate the read hits:

Stage Log prefix What it tells you
BAM read & filter (various, from SvabaBamWalker) Dup/QC/blacklist gates, rule_pass, NM salvage, adapter filter, quality trim, buffer admission
BFC error correction BFC corrected: Whether BFC changed the sequence and by how much
R2C alignment R2C SKIP: / R2C HIT: Perfect-ref-match skip, or which contigs the read aligned to (AS score, CIGAR)
Native realignment NATIVE_REALIGN: Whether the corrected seq was re-aligned to ref or reused the BAM CIGAR
Split coverage scoring SPLIT_COV enter Entry into per-BP scoring with r2c coords and breakpoint positions
R2C vs native gate SPLIT_COV TP8 The critical score comparison: r2c_score, native_score, both CIGARs, NM values
Indel-at-break check SPLIT_COV TP9 Whether an r2c CIGAR indel lands at the breakpoint
Span check SPLIT_COV TP10 Whether the read spans the breakpoint(s), with exact coord bounds
DEL-covers-break SPLIT_COV TP11 Whether an r2c deletion masks the breakpoint
Final verdict SPLIT_COV CREDITED / NOT CREDITED / SKIPPED Did this read count as a variant supporter?
Output tagging OUTPUT TAG bi:Z BP id stamped on the read, confidence, somatic status

Example trace (abridged) for a read supporting a somatic 1bp deletion:

[READ_TRACE:SvabaBamWalker.cpp:203] read=LH00306:129:... flag=163 mapq=60 pos=chr2:215869800 ...
[READ_TRACE:SvabaBamWalker.cpp:236] PASS mr.isValid rule_pass=1
[READ_TRACE:SvabaBamWalker.cpp:340] ADDED to read buffer (n=847)
[READ_TRACE:SvabaRegionProcessor.cpp:377] BFC corrected: changed=NO ...
[READ_TRACE:SvabaRegionProcessor.cpp:808] R2C HIT: contig=c_fermi_chr2_... AS=150 rc=0 CIGAR=75M1D74M
[READ_TRACE:SvabaRegionProcessor.cpp:978] NATIVE_REALIGN: reusing BAM CIGAR (seq unchanged by BFC)
[READ_TRACE:BreakPoint.cpp:379] SPLIT_COV enter contig=c_fermi_chr2_... r2c_start=340 r2c_end=489 ...
[READ_TRACE:BreakPoint.cpp:476] SPLIT_COV TP8 PASS r2c>native r2c_score=150 native_score=143 ...
[READ_TRACE:BreakPoint.cpp:601] SPLIT_COV TP10 span check issplit1=1 issplit2=1 one_split=1
[READ_TRACE:BreakPoint.cpp:697] SPLIT_COV CREDITED as variant supporter sample=t000 tumor=1
[READ_TRACE:SvabaRegionProcessor.cpp:1346] OUTPUT TAG bi:Z bp_id=bp00100000042 confidence=PASS somatic=1

Trace a specific contig

cmake -B build -DCMAKE_BUILD_TYPE=RelWithDebInfo \
      -DCMAKE_CXX_FLAGS='-DSVABA_TRACE_CONTIG="\"c_fermi_chr2_215869501_215894501_13C\""'
cmake --build build -j$(nproc)

Shows assembly filtering (TP1–TP5), variant identification (TP6), per-read split-coverage scoring (TP8–TP11), breakpoint confidence (TP13–TP16, TP23).

Trace both a read AND a contig simultaneously

cmake -B build \
      -DCMAKE_CXX_FLAGS='-DSVABA_TRACE_READ="\"LH00306:129:227V5CLT4:6:1204:38807:7191\"" \
                          -DSVABA_TRACE_CONTIG="\"c_fermi_chr2_215869501_215894501_13C\""'
cmake --build build -j$(nproc)

Independent prefixes ([READ_TRACE:...] vs [TRACE:...]) — grep for either.

Trace ALL reads or ALL contigs (very noisy)

cmake ... -DCMAKE_CXX_FLAGS='-DSVABA_TRACE_ALL_READS=1'   # every read
cmake ... -DCMAKE_CXX_FLAGS='-DSVABA_TRACE_ALL=1'          # every contig

Best combined with a small -k region.

Finding a read's QNAME to trace

# From bps.txt.gz — get contig name (col 30) and bp_id (col 52)
zcat results.bps.txt.gz | awk -F'\t' '$1=="chr2" && $2 > 215869000 && $2 < 215870000'

# From the corrected BAM — reads tagged with a specific bp_id
samtools view results.corrected.bam chr2:215869000-215870000 | grep "bi:Z:.*bp00100000042"

# From the r2c TSV — all reads for a contig
zcat results.r2c.txt.gz | awk -F'\t' '$2 == "c_fermi_chr2_215869501_215894501_13C" && $1 == "read"' | cut -f8

Restrict assembly to reads containing a specific kmer

cmake -B build -DCMAKE_BUILD_TYPE=RelWithDebInfo \
      -DCMAKE_CXX_FLAGS='-DSVABA_KMER_RESTRICT="\"CCATGCAGAGTGTTGAAGAAAAGGC\""'
cmake --build build -j$(nproc)

After BFC error correction, only reads whose corrected sequence contains the specified kmer (or its reverse complement) survive. All other reads get to_assemble = false — they won't enter fermi assembly, r2c alignment, corrected.bam, or scoring. The log prints kept/dropped counts per region.

Use case: you see a suspicious contig and want to know whether assembly still produces it when restricted to reads from a particular locus. Pick a 25-mer unique to that locus, compile with SVABA_KMER_RESTRICT, and run on the same region:

svaba run -t tumor.bam -n normal.bam -G ref.fa -k chr11:5000000-5100000 \
          -a kmer_test --dump-reads -p 1

If the chimeric contig still assembles, the kmer-carrying reads are sufficient to produce it. If it disappears, reads from elsewhere were required.

Can be combined with read/contig tracing:

cmake -B build \
      -DCMAKE_CXX_FLAGS='-DSVABA_KMER_RESTRICT="\"CCATGCAGAGTGTTGAAGAAAAGGC\"" \
                          -DSVABA_TRACE_CONTIG="\"c_fermi_chr11_5000001_5100001_3C\""'

Disable the r2c-vs-native gate (for debugging only)

cmake ... -DCMAKE_CXX_FLAGS='-DSVABA_R2C_NATIVE_GATE=0'

Restores old behavior where any r2c-spanning read credits as variant supporter. Will reintroduce false-positive somatic calls from homology-trap reads.


Alt-contig demotion

BWA-MEM sometimes places a contig fragment on an alt contig (e.g. chr11_JH159136v1_alt) when chr11 proper has an equally good alignment. If the alt later gets blacklisted, the real breakpoint is lost.

svaba now requests secondary alignments for contigs and runs a post-alignment step (preferStandardChromosomes): for each primary/supplementary fragment on a non-standard chromosome (ChrID > maxMateChrID, default 23), it looks for a secondary alignment on a standard chromosome that:

  • Covers ≥ 80% of the same query range (reciprocal overlap)
  • Has AS ≥ 95% of the non-standard alignment's AS

If found, the standard-chr alignment is promoted (gets the primary/supplementary flag) and the non-standard one is demoted to secondary. The contig trace (SVABA_TRACE_CONTIG) logs each swap with both chromosome IDs and alignment scores.

This is controlled by --max-mate-chr (same constant used for mate-region lookup). --non-human sets it to -1, which disables alt-demotion entirely (no chromosome is "non-standard").


Recipes

Germline-only. Raise the mate-lookup threshold so only larger discordant clusters trigger a cross-region lookup — more conservative and usually appropriate for a single-sample germline run where we don't have a built-in control to guard against mapping artifacts (a tumor would typically see smaller, subclonal clusters we want to chase down). Add --single-end to disable mate lookups entirely if you want to be even more conservative:

svaba run -t germline.bam -p 8 --mate-min 6 -a germline_run \
          -G ref.fa \
          --blacklist tracks/hg38.combined_blacklist.bed

Targeted assembly over a list of regions (BED, chr, or IGV-style string):

svaba run -t sample.bam -k targets.bed -a exome_cap -G ref.fa
svaba run -t sample.bam -k chr17:7,541,145-7,621,399 -a TP53 -G ref.fa

Dump all per-read evidence (large output, only for debugging a specific call):

svaba run -t sample.bam -G ref.fa -a debug_run --dump-reads
scripts/svaba_postprocess.sh -t 8 -m 4G debug_run

Non-human genome (e.g. mouse, zebrafish, C. elegans). By default svaba assumes a human reference: mate-region lookups skip chromosomes past chrY (ChrID > 23), and insert-size learning samples only the primary assembly (chr1–chrY). --non-human removes these gates so every contig in the reference is treated equally:

svaba run -t mouse.bam -G mm39.fa -a mouse_run --non-human -p 16

The flag sets maxMateChrID = -1 internally. You can also fine-tune individually: --max-mate-chr 19 (mouse has 19 autosomes + X + Y = ChrIDs 0–20 in a typical reference), --min-mate-mapq 10 (require MAPQ ≥ 10 on the primary read before chasing its mate).

Snapshot where a long-running job currently is:

tail my_run.log

Further reading

CLAUDE.md at the repo root is the crash-safety-net doc — conventions, file landmarks, build-system quirks (the -O2 hardcoding in submodules), the somatic LOD model, the postprocess pipeline details, performance notes, and open investigations. Always update CLAUDE.md when you change something non-obvious.

scripts/svaba_local_function.sh is a sourceable bash helper library with svaba_* utilities for grepping contigs, following a bp_id through the output set, opening locations in IGV, etc. Source it from your shell rc file to use.

Issues and contact

Please file bug reports, feature requests, and questions on the GitHub issues tracker: https://github.com/walaj/svaba/issues.

Attributions

SvABA is developed by Jeremiah Wala in the Rameen Berkoukhim lab at Dana-Farber Cancer Institute, in collaboration with the Cancer Genome Analysis team at the Broad Institute. Particular thanks to Cheng-Zhong Zhang (HMS DBMI) and Marcin Imielinski (Weill Cornell / NYGC).

Additional thanks to Jared Simpson for SGA, Heng Li for htslib and BWA, and the SeqLib contributors.

The SvABA 2.0 release and its documentation were built with the assistance of OpenAI Codex and Anthropic Claude, with extensive human-in-the-loop review, testing, and decision-making throughout.